View this protocol on protocols.io

Standard library prep protocol

The 16S protocol detailed here is designed to amplify prokaryotes (bacteria and archaea) using paired-end 16S community sequencing on the Illumina platform. Primers 515F–806R target the V4 region of the 16S SSU rRNA.
For running these libraries on the MiSeq and HiSeq, please make sure you read the supplementary methods of Caporaso et al. (2012). You will need to make your sample more complex by adding 5–10% PhiX to your run.

High-throughput miniaturized library prep protocol

As of 2018, the EMP has switched to a low-cost, miniaturized (5-µl volume), high-throughput (384-sample) amplicon library preparation method with the Echo 550 acoustic liquid handler (Minich et al., 2018).

16S V4 amplification primers

The current primers have been modified from the original 515F–806R primer pair (Caporaso et al., 2011) in the following ways:

1. Barcodes are now on the forward primer 515F (Parada et al., 2016). This enables the usage of various reverse primer constructs to obtain longer amplicons, for example the V4–V5 region using reverse primer 926R (Quince et al., 2011; Parada et al., 2016).
2. Degeneracy was added to both the forward and reverse primers to remove known biases against Crenarachaeota/Thaumarchaeota (515F, also called 515F-Y, Parada et al., 2016) and the marine and freshwater Alphaproteobacterial clade SAR11 (806R, Apprill et al., 2015).

The primer sequences without linker, pad, barcode, or adapter are as follows:

• • Updated sequences: 515F (Parada)–806R (Apprill), forward-barcoded:
    FWD:GTGYCAGCMGCCGCGGTAA; REV:GGACTACNVGGGTWTCTAAT
  • Original sequences: 515F (Caporaso)–806R (Caporaso), reverse-barcoded:
    FWD:GTGCCAGCMGCCGCGGTAA; REV:GGACTACHVGGGTWTCTAAT

Note on primer names: Previously we had named the updated primers “515FB” and “806RB” to distinguish them from the original primers. However, the “B” could be misinterpreted as barcode, and these names do not appear in the literature. Therefore we now use the original names following by the lead author to avoid ambiguity, i.e., “515F (Parada)”, “806R (Apprill)”, and “926R (Quince)”. Always check the primer sequence in addition to the primer name.
Note for Qiita users: Studies in the Qiita database will have library_construction_protocol as 515f/806rbc if original primers or 515fbc/806r if current primers (“bc” stands for barcode). The updated, forward-barcoded primer sequences (Parada, Apprill) were implemented by the Knight Lab starting in 2015.

Ordering primers

The primer sequences in this protocol are always listed in the 5′ -> 3′ orientation. This is the orientation that should be used for ordering. See the page Primer Ordering and Resuspension for more information. Primers and primer constructs were designed by Greg Caporaso (2011, 2012). Modifications to primer degeneracy were done by the labs of Jed Furhman (Parada et al., 2016) and Amy Apprill (Apprill et al., 2015). Forward-barcoded constructs were redesigned by Walters et al. (2016) based upon the original constructs generated by Caporaso et al. (2012). The 926R R2 sequencing primer was extended (it includes a fragment of the 3’ adapter) to increase the Tm (which the MiSeq in particular was sensitive to).

• Illumina 16S V4 Primer Constructs (515F-806R)
• Illumina 16S V4-V5 Primer Constructs (515F-926R)

515F forward primer, barcoded

Field descriptions (space-delimited):

1. 5′ Illumina adapter
2. Golay barcode
3. Forward primer pad
4. Forward primer linker
5. Forward primer (515F)

AATGATACGGCGACCACCGAGATCTACACGCT XXXXXXXXXXXX TATGGTAATT GT GTGYCAGCMGCCGCGGTAA

806R reverse primer

Field descriptions (space-delimited):

1. Reverse complement of 3′ Illumina adapter
2. Reverse primer pad
3. Reverse primer linker
4. Reverse primer (806R)

CAAGCAGAAGACGGCATACGAGAT AGTCAGCCAG CC GGACTACNVGGGTWTCTAAT

PCR reaction mixture

Notes:

• PCR-grade water from Sigma (cat. no. W3500) or MoBio (cat. no. 17000-11)
• Platinum Hot Start PCR Master Mix (2x) from ThermoFisher (cat. no. 13000014)
• Final master mix concentration in 1x reaction: 0.8x
• Final primer concentration in 1x reaction: 0.2 µM

Thermocycler conditions

• Primers: 16S V4 515F–806R
• Amplicon size: ~390 bp
• Cycle times are longer for 384-well thermocyclers; these conditions should also work for 96-well thermocyclers.

Amplification protocol

1. Amplify samples in triplicate, meaning each sample will be amplified in 3 replicate 25-µL PCR reactions.
2. Pool triplicate PCR reactions for each sample into a single volume (75 µL). Do not combine amplicons from different samples at this point.
3. Run amplicons from each sample on an agarose gel. Expected band size for 515F–806R is ~300–350 bp. Low-biomass samples may yield faint or no visible bands; alternative methods such as a Bioanalyzer could be used to verify presence of PCR product.
4. Quantify amplicons with Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher/Invitrogen cat. no. P11496; follow manufacturer’s instructions).
5. Combine an equal amount of amplicon from each sample (240 ng) into a single, sterile tube. Higher amounts can be used if the final pool will be gel-isolated or when working with low-biomass samples. Note: When working with multiple plates of samples, it is typical to produce a single tube of amplicons for each plate of samples.
6. Clean amplicon pool using MoBio UltraClean PCR Clean-Up Kit (cat. no. 12500; follow manufacturer’s instructions). If working with more than 96 samples, the pool may need to be split evenly for cleaning and then recombined. Optional: If spurious bands were present on gel (in step 3), one-half of the final pool can be run on a gel and then gel extracted to select only the target bands.
7. Measure concentration and A260/A280 ratio of final pool that has been cleaned. For best results the A260/A280 ratio should be between 1.8–2.0.
8. Send an aliquot for sequencing along with sequencing primers listed below.

16S sequencing primers

Read 1 sequencing primer

Field descriptions (space-delimited):

1. Forward primer pad
2. Forward primer linker
3. Forward primer

TATGGTAATT GT GTGYCAGCMGCCGCGGTAA

Read 2 sequencing primer

Field descriptions (space-delimited):

1. Reverse primer pad
2. Reverse primer linker
3. Reverse primer

AGTCAGCCAG CC GGACTACNVGGGTWTCTAAT

Index sequencing primer

AATGATACGGCGACCACCGAGATCTACACGCT
Note: The 5′ adapter sequence/index sequencing primer has an extra GCT at its 3′ end compared to Illumina’s usual index primer sequences. These bases were added to the 3′ end of the Illumina 5′ adapter sequence to increase the Tm for read 1 during sequencing.

References

• Apprill, A., McNally, S., Parsons, R., & Weber, L. (2015). Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquatic Microbial Ecology, 75(2), 129–137. http://doi.org/10.3354/ame01753
• Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Lozupone, C. A., Turnbaugh, P. J., Noah Fierer, N., & Knight, R. (2011). Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc Natl Acad Sci USA 108, 4516–4522. http://doi.org/10.1073/pnas.1000080107
• Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S. M., Betley, J., Fraser, L., Bauer, M., Gormley, N., Gilbert, J. A., Smith, G., & Knight, R. (2012). Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J 6, 1621–1624. http://doi.org/10.1038/ismej.2012.8
• Minich, J. J., Humphrey, G., Benitez, R. A. S., Sanders, J., Swafford, A., Allen, E. E., et al. (2018). High-throughput miniaturized 16S rRNA amplicon library preparation reduces costs while preserving microbiome integrity. mSystems, 3(6), e00166–18. http://doi.org/10.1128/mSystems.00166-18
• Parada, A. E., Needham, D. M., & Fuhrman, J. A. (2016). Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environmental Microbiology, 18(5), 1403–1414. http://doi.org/10.1111/1462-2920.13023
• Quince, C., Lanzen, A., Davenport, R.J., & Turnbaugh, P.J. (2011) Removing noise from pyrosequenced amplicons. BMC Bioinformatics 12: 38. https://doi.org/10.1186/1471-2105-12-38
• Walters, W., Hyde, E. R., Berg-Lyons, D., Ackermann, G., Humphrey, G., Parada, A., Gilbert, J. A., Jansson, J. K., Caporaso, J. G., Fuhrman, J. A., Apprill, A., & Knight, R. (2016). Improved bacterial 16S rRNA gene (V4 and V4-5) and fungal internal transcribed spacer marker gene primers for microbial community surveys. mSystems, 1(1), e00009–15. http://doi.org/10.1128/mSystems.00009-15

Change log

• October 2018 – Changed primer names to “515F (Parada)”, “806R (Apprill)”, and “926R (Quince)”. See: Note on primer names.
• December 2018 – Added link to high-throughput miniaturized library prep protocol (Minich et al., 2018).