View this protocol on protocols.io
The 18S protocol detailed here is designed to amplify eukaryotes broadly with a focus on microbial eukaryotic lineages. The primers target the 18S SSU rRNA and are based on those of Amaral-Zettler et al. (2009) and Stoek et al. (2010). The constructs are designed to be used with the Illumina platform. The forward primer, 1391f, is a universal primer, while the EukBr reverse primer favors eukaryotes, but can, with mismatch(s), bind and amplify bacteria and archaea.
For running these libraries on the MiSeq and HiSeq, please make sure you read the supplementary methods of Caporaso et al. (2012). You will need to make your sample more complex by adding 5-10% PhiX to your run.
The outlines of the protocol are the same as the 16S protocol, but different primers, PCR conditions, and sequencing primers are used. In addition, we have designed a blocking primer that reduces the amplification of vertebrate host DNA to be used on host-associated samples, especially those that have a low eukaryotic biomass. Blocking primer strategy is based on Vestheim et al. (2008).

Ordering primers

The primer sequences in this protocol are always listed in the 5′ -> 3′ orientation. This is the orientation that should be used for ordering. See the page Primer Ordering and Resuspension. Primer constructs were designed by Laura Wegener Parfrey.

• Illumina 18S Primer Constructs (Euk1391f-EukBr)

Illumina_Euk_1391f forward primer

Field descriptions (space-delimited):

1. 5′ Illumina adapter
2. Forward primer pad
3. Forward primer linker
4. Forward primer (1391f)

AATGATACGGCGACCACCGAGATCTACAC TATCGCCGTT CG GTACACACCGCCCGTC

Illumina_EukBr reverse primer, barcoded

1. Reverse complement of 3′ Illumina adapter
2. Golay barcode
3. Reverse primer pad
4. Reverse primer linker
5. Reverse primer (EukBr)

CAAGCAGAAGACGGCATACGAGAT XXXXXXXXXXXX AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC

Mammal_block_I-short_1391f mammal blocking primer

The mammal blocking primer is to be used when there is a high probability of picking up host genomic DNA. The C3 spacer (/3SpC3/) is a chemical modification that prevents extension during the PCR. Please note that the use of blocking primer reduces the number of host sequences detected but does not completely eliminate them. Thus remaining host sequences should also be filtered out during the analysis phase. We have found blocking primers to be particularly useful for host-associated samples with a low biomass of eukaryotic DNA. Note: Sequence is formatted for ordering from IDT.
GCCCGTCGCTACTACCGATTGG/ideoxyI//ideoxyI//ideoxyI//ideoxyI//ideoxyI/TTAGTGAGGCCCT/3SpC3/

PCR reaction mixture

No blocking primer

With blocking primer

Notes:

• PCR-grade water from Sigma (cat. no. W3500) or MoBio (cat. no. 17000-11)
• Platinum Hot Start PCR Master Mix (2x) from ThermoFisher (cat. no. 13000014)
• Final master mix concentration in 1x reaction: 0.8x
• Final primer concentration in 1x reaction: 0.2 µM
• Final blocking primer concentration in 1x reaction: 1.6 µM

Thermocycler conditions

• Primers: 18S V9 1391f-1510r
• Amplicon size: ~260 +/- 50 bp
• Temperatures and cycle times are different with and without blocking primer.
• Conditions have been tested on both 96-well and 384-well thermocyclers.

No blocking primer

With blocking primer

Amplification protocol

1. Amplify samples in triplicate, meaning each sample will be amplified in 3 replicate 25-µL PCR reactions.
2. Pool triplicate PCR reactions for each sample into a single volume (75 µL). Do not combine amplicons from different samples at this point.
3. Run amplicons from each sample on an agarose gel. Expected band size for 1391f-Eukbr is ~260 bp. Low-biomass samples may yield faint or no visible bands; alternative methods such as a Bioanalyzer could be used to verify presence of PCR product.
4. Quantify amplicons with Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher/Invitrogen cat. no. P11496; follow manufacturer’s instructions).
5. Combine an equal amount of amplicon from each sample (240 ng) into a single, sterile tube. Higher amounts can be used if the final pool will be gel-isolated or when working with low-biomass samples. Note: When working with multiple plates of samples, it is typical to produce a single tube of amplicons for each plate of samples.
6. Clean amplicon pool using MoBio UltraClean PCR Clean-Up Kit (cat. no. 12500; follow manufacturer’s instructions). If working with more than 96 samples, the pool may need to be split evenly for cleaning and then recombined. Optional: If spurious bands were present on gel (in step 3), one-half of the final pool can be run on a gel and then gel extracted to select only the target bands.
7. Measure concentration and A260/A280 ratio of final pool that has been cleaned. For best results the A260/A280 ratio should be between 1.8-2.0.
8. Send an aliquot for sequencing along with sequencing primers listed below.

18S sequencing primers

Euk_illumina_read1_seq_primer

Field descriptions (space-delimited):

1. Forward primer pad
2. Forward primer linker
3. Forward primer (1391f)

TATCGCCGTT CG GTACACACCGCCCGTC

Euk_illumina_read2_seq_primer

Field descriptions (space-delimited):

1. Reverse primer pad
2. Reverse primer linker
3. Reverse primer (EukBr)

AGTCAGTCAG CA TGATCCTTCTGCAGGTTCACCTAC

Euk_illumina_index_seq_primer

Field description (space-delimited):

1. Reverse complement of reverse primer (EukBr)
2. Reverse complement of reverse primer linker
3. Reverse complement of reverse primer pad

GTAGGTGAACCTGCAGAAGGATCA TG CTGACTGACT

References

• Amaral-Zettler, L. A., McCliment, E. A., Ducklow, H. W., & Huse, S. M. (2009). A method for studying protistan diversity using massively parallel sequencing of V9 hypervariable regions of small-subunit ribosomal RNA Genes. PLoS ONE, 4(7), e6372. http://doi.org/10.1371/journal.pone.0006372
• Caporaso, J. G., Lauber, C. L., Walters, W. A., Berg-Lyons, D., Huntley, J., Fierer, N., Owens, S. M., Betley, J., Fraser, L., Bauer, M., Gormley, N., Gilbert, J. A., Smith, G., & Knight, R. (2012). Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J 6, 1621–1624. http://doi.org/10.1038/ismej.2012.8
• Stoeck, T., Bass, D., Nebel, M., Christen, R., Jones, M. D. M., Breiner, H.-W., & Richards, T. A. (2010). Multiple marker parallel tag environmental DNA sequencing reveals a highly complex eukaryotic community in marine anoxic water. Molecular Ecology, 19 Suppl 1, 21–31. http://doi.org/10.1111/j.1365-294X.2009.04480.x
• Vestheim, H., & Jarman, S. N. (2008). Blocking primers to enhance PCR amplification of rare sequences in mixed samples – a case study on prey DNA in Antarctic krill stomachs. Front Zoo, 5(1), 12. http://doi.org/10.1186/1742-9994-5-12